Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06381

HP ID(1) HP06381
Gene ID(2) 284252
Gene Symbol finder KCTD1
Protein Name potassium channel tetramerisation domain containing 1
RefSeq NM_198991.2
Length of RefSeq (bp) 1754
Chromosome 18q11.2
Reference DDBJ accession
UniGene Hs.526630

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh11G08 pGCAP1 TGGCCCTGGCCGCGGGCGCCGAGAGGGTGCGGGGCCTCGCCGTGCCTCCTCCAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl