Prev. |  KEGG KO K21754 > 

RIKEN DNA Bank Human Resource - KCTD1

Gene ID NCBI Gene 284252 |  KEGG hsa:284252
Gene Symbol KCTD1
Protein Name potassium channel tetramerization domain containing 1
Synonyms C18orf5
Ortholog resource in our bank

  KCTD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX053927 IRAK134N15 pCMV-SPORT6.ccdb BC063652 NM_198991 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE091601 M01C029A01 pDONR221 MGC04-A01 BC063652 NM_198991  
HGE091649 M01C029C01 pDONR221 MGC04-A01 BC063652 NM_198991  
HGE091697 M01C029E01 pDONR221 MGC04-A01 BC063652 NM_198991  
HGE091745 M01C029G01 pDONR221 MGC04-A01 BC063652 NM_198991  
HGE091793 M01C029I01 pDONR221 MGC04-A01 BC063652 NM_198991  
HGE091841 M01C029K01 pDONR221 MGC04-A01 BC063652 NM_198991  
HGE091889 M01C029M01 pDONR221 MGC04-A01 BC063652 NM_198991  
HGE091937 M01C029O01 pDONR221 MGC04-A01 BC063652 NM_198991  
HGE099217 M01C048A17 pDONR221 MGC13-E09 BC063652 NM_198991  
HGE099265 M01C048C17 pDONR221 MGC13-E09 BC063652 NM_198991  
HGE099313 M01C048E17 pDONR221 MGC13-E09 BC063652 NM_198991  
HGE099361 M01C048G17 pDONR221 MGC13-E09 BC063652 NM_198991  
HGE099409 M01C048I17 pDONR221 MGC13-E09 BC063652 NM_198991  
HGE099457 M01C048K17 pDONR221 MGC13-E09 BC063652 NM_198991  
HGE099505 M01C048M17 pDONR221 MGC13-E09 BC063652 NM_198991  
HGE099553 M01C048O17 pDONR221 MGC13-E09 BC063652 NM_198991  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR124552 ARh11G08 pGCAP1 NM_198991.2  
TGGCCCTGGCCGCGGGCGCCGAGAGGGTGCGGGGCCTCGCCGTGCCTCCTCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl