Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06379

HP ID(1) HP06379
Gene ID(2) 5916
Gene Symbol finder RARG
Protein Name retinoic acid receptor, gamma
RefSeq NM_000966.4
Length of RefSeq (bp) 2992
Chromosome 12q13
Reference DDBJ accession
UniGene Hs.1497

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh11F04 pGCAP1 AAATGTGGGAGGGAGAAAAAGAAAGAAAATATTTTCCGTGTCCCCGCCTGCAGAGTCAGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl