Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06367

HP ID(1) HP06367
Gene ID(2) 51555
Gene Symbol finder PEX5L
Protein Name peroxisomal biogenesis factor 5-like
RefSeq NM_016559.1
Length of RefSeq (bp) 3577
Chromosome 3q26.33
Reference DDBJ accession
UniGene Hs.478393

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh10G02 pGCAP1 GGCGCGCCCCGCTCGGCAGCTGCGGCGGCGGCTGGTGTAGGCGCTCACGTCAGGGCTGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl