Prev. |  KEGG KO K13342 > 

RIKEN DNA Bank Human Resource - PEX5L

Gene ID NCBI Gene 51555 |  KEGG hsa:51555
Gene Symbol PEX5L
Protein Name peroxisomal biogenesis factor 5 like
Synonyms PEX5R|PEX5RP|PXR2|PXR2B|TRIP8b
Ortholog resources KEGG ortholog (KEGG orthology K13342) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR124146 ARh10G02 pGCAP1 NM_016559.1  
GGCGCGCCCCGCTCGGCAGCTGCGGCGGCGGCTGGTGTAGGCGCTCACGTCAGGGCTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl