Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06362

HP ID(1) HP06362
Gene ID(2) 64326
Gene Symbol finder RFWD2
Protein Name ring finger and WD repeat domain 2
RefSeq NM_001001740.2
Length of RefSeq (bp) 2729
Chromosome 1q25.1-q25.2
Reference DDBJ accession
UniGene Hs.523744

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh10B03 pGCAP1 GGGAGGCGGCGGAGGGTCGAGGTCGCGGTCCCTCTCCTCCGAGCGCCCGGCTGGAGGGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl