Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06355

HP ID(1) HP06355
Gene ID(2) 6929
Gene Symbol finder TCF3
Protein Name transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)
RefSeq NM_003200.2
Length of RefSeq (bp) 4462
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.371282

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh09D11 pGCAP1 GGTAGCGGGCCGGAGCCGACGCGGCGGCGGGCACCGCGGGCACCGCGCACGCCGCTGCCC
RBd66D02 pGCAP10 ACGANGCANNGGCGGCGGCTGCGGGCGTAGCGGGCCGGANCCGACGCGGCGGCGGNCACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl