Prev. | Human A to Z list > T > 

RIKEN DNA Bank Human Resource - TCF3

Gene ID (NCBI) 6929
Gene Symbol TCF3
Protein Name transcription factor 3
Synonyms E2A|E47|ITF1|TCF-3|VDIR|bHLHb21
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Signaling pathways regulating pluripotency of stem cells (human)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03785 SEREX clone NGO-St-009 (ID 16) #1 SEREX clone NGO-St-009 (ID 16) #1

RDB_hum_160722.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY084687 IRAL011L23 pOTB7 BC005166 NM_003200 Partial/var
HGY090432 IRAL026B08 pOTB7 BC011665 NM_003200 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR123683 ARh09D11 pGCAP1 NM_003200.2 done
GGTAGCGGGCCGGAGCCGACGCGGCGGCGGGCACCGCGGGCACCGCGCACGCCGCTGCCC
HKR386474 RBd66D02 pGCAP10 NM_003200.2 done
ACGANGCANNGGCGGCGGCTGCGGGCGTAGCGGGCCGGANCCGACGCGGCGGCGGNCACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.13

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl