Prev. |  KEGG KO K09063 > 

RIKEN DNA Bank Human Resource - TCF3

Gene ID NCBI Gene 6929 |  KEGG hsa:6929
Gene Symbol TCF3
Protein Name transcription factor 3
Synonyms AGM8|E2A|E47|ITF1|TCF-3|VDIR|bHLHb21|p75
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Ortholog resource in our bank

  TCF3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03785 SEREX clone NGO-St-009 (ID 16) #1 SEREX clone NGO-St-009 (ID 16) #1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084687 IRAL011L23 pOTB7 BC005166 NM_003200 Partial/var
HGY090432 IRAL026B08 pOTB7 BC011665 NM_003200 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR123683 ARh09D11 pGCAP1 NM_003200.2 done
GGTAGCGGGCCGGAGCCGACGCGGCGGCGGGCACCGCGGGCACCGCGCACGCCGCTGCCC
HKR386474 RBd66D02 pGCAP10 NM_003200.2 done
ACGANGCANNGGCGGCGGCTGCGGGCGTAGCGGGCCGGANCCGACGCGGCGGCGGNCACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl