Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06354

HP ID(1) HP06354
Gene ID(2) 57291
Gene Symbol finder KIAA0114
Protein Name KIAA0114
RefSeq NR_024031.1
Length of RefSeq (bp) 855
Chromosome 4q12
Reference DDBJ accession
UniGene Hs.17719

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe10C06 pKA1U5 AB371444 AGGTCGCAGGCCTCTTTGTCAGCTGGAGTTGCGCGGGCTGACGCGCCACTATGTAGCGGG
ARe83D03 pKA1U5 ATGCTCTTTGTCAGCTGGAGTTGCGCGGGCTGACGCGCCACTATGTAGCGGGTTTCGGGC
ARi70A07 pGCAP10 GAGCCCCCTAGCGCGCCTGCGCAGCGGGCCACTCTCTGCTTTCCCCCCCTCCCCTTCCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl