Prev. | 

RIKEN DNA Bank Human Resource - DANCR

Gene ID NCBI Gene 57291 |  KEGG hsa:57291
Gene Symbol DANCR
Protein Name differentiation antagonizing non-protein coding RNA
Synonyms AGU2|ANCR|KIAA0114|SNHG13|lncRNA-ANCR
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008851 IRAK022C03 pCMV-SPORT6 BC015222
HGY042462 IRAK106C14 pBluescript BC045566

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044054 ARe10C06 pKA1U5 NR_024031.1  
AGGTCGCAGGCCTCTTTGTCAGCTGGAGTTGCGCGGGCTGACGCGCCACTATGTAGCGGG
HKR073275 ARe83D03 pKA1U5 NR_024031.1  
ATGCTCTTTGTCAGCTGGAGTTGCGCGGGCTGACGCGCCACTATGTAGCGGGTTTCGGGC
HKR188007 ARi70A07 pGCAP10 NR_024031.1  
GAGCCCCCTAGCGCGCCTGCGCAGCGGGCCACTCTCTGCTTTCCCCCCCTCCCCTTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl