Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06350

HP ID(1) HP06350
Gene ID(2) 80222
Gene Symbol finder TARS2
Protein Name threonyl-tRNA synthetase 2, mitochondrial (putative)
RefSeq NM_025150.3
Length of RefSeq (bp) 2390
Chromosome 1q21.2
Reference DDBJ accession
UniGene Hs.288974

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh09A06 pGCAP1 GAGGCACTGGTGTGA.AGGAACATGGCCCTGTATCAGAGGTGGCGG.TGTCTCC
RBd45A06 pGCAP10 GAGAAGCGGCGATAATCTGTTTGAGGATGTAGGCACTGGTGTGAAGGAACATGGCCCTGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl