Prev. |  KEGG KO K01868 > 

RIKEN DNA Bank Human Resource - TARS2

Gene ID NCBI Gene 80222 |  KEGG hsa:80222
Gene Symbol TARS2
Protein Name threonyl-tRNA synthetase 2, mitochondrial
Synonyms COXPD21|TARSL1|thrRS
Ortholog resource in our bank

  TARS2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082017 IRAL005A17 pOTB7 BC000541 NM_025150 Full
HGY088002 IRAL020A02 pOTB7 BC007824 NM_025150 Partial
HGY090638 IRAL026J22 pOTB7 BC009997 NM_025150

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR123606 ARh09A06 pGCAP1 NM_025150.3  
GAGGCACTGGTGTGA.AGGAACATGGCCCTGTATCAGAGGTGGCGG.TGTCTCC
HKR378006 RBd45A06 pGCAP10 NM_025150.3  
GAGAAGCGGCGATAATCTGTTTGAGGATGTAGGCACTGGTGTGAAGGAACATGGCCCTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl