Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06348

HP ID(1) HP06348
Gene ID(2) 738
Gene Symbol finder C11orf2
Protein Name chromosome 11 open reading frame2
RefSeq NM_013265.2
Length of RefSeq (bp) 2546
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.277517

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh08D02 pGCAP1 TGGTCCNGCCTCACGCCCGTGGGCTGCAGTTGGAACGATGGCGGCGGCAGCTGCCGCCGG
RBd09B09 pGCAP10 GAGTTGGAACGATGGCGGCGGCAGCTGCCGCCGGGCCTAGCCCGGGGTCTGGACCTGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl