Prev. |  KEGG KO K20296 > 

RIKEN DNA Bank Human Resource - VPS51

Gene ID NCBI Gene 738 |  KEGG hsa:738
Gene Symbol VPS51
Protein Name VPS51 subunit of GARP complex
Synonyms ANG2|ANG3|C11orf2|C11orf3|FFR|PCH13
Ortholog resource in our bank

  VPS51

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007779 IRAK019H11 pCMV-SPORT6 BC010540 NM_013265 Full
HGY081011 IRAL002I19 pOTB7 BC006555 NM_013265 Partial
HGY087222 IRAL018A22 pOTB7 BC017438 NM_013265 Full
HGY087246 IRAL018B22 pOTB7 BC007198 NM_013265 Full
HGY088281 IRAL020L17 pOTB7 BC009285 NM_013265 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE108407 M01C071A07 pDONR221 06_10-A04 BC007198 NM_013265  
HGE108455 M01C071C07 pDONR221 06_10-A04 BC007198 NM_013265  
HGE108503 M01C071E07 pDONR221 06_10-A04 BC007198 NM_013265  
HGE108551 M01C071G07 pDONR221 06_10-A04 BC007198 NM_013265  
HGE108599 M01C071I07 pDONR221 06_10-A04 BC007198 NM_013265  
HGE108647 M01C071K07 pDONR221 06_10-A04 BC007198 NM_013265  
HGE108695 M01C071M07 pDONR221 06_10-A04 BC007198 NM_013265  
HGE108743 M01C071O07 pDONR221 06_10-A04 BC007198 NM_013265  
HGE124836 M01C112B12 pDONR221 06-2_04-H06 BC007198 NM_013265  
HGE124884 M01C112D12 pDONR221 06-2_04-H06 BC007198 NM_013265  
HGE124932 M01C112F12 pDONR221 06-2_04-H06 BC007198 NM_013265  
HGE124980 M01C112H12 pDONR221 06-2_04-H06 BC007198 NM_013265  
HGE125028 M01C112J12 pDONR221 06-2_04-H06 BC007198 NM_013265  
HGE125076 M01C112L12 pDONR221 06-2_04-H06 BC007198 NM_013265  
HGE125124 M01C112N12 pDONR221 06-2_04-H06 BC007198 NM_013265  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR123274 ARh08D02 pGCAP1 NM_013265.2  
TGGTCCNGCCTCACGCCCGTGGGCTGCAGTTGGAACGATGGCGGCGGCAGCTGCCGCCGG
HKR363633 RBd09B09 pGCAP10 NM_013265.2  
GAGTTGGAACGATGGCGGCGGCAGCTGCCGCCGGGCCTAGCCCGGGGTCTGGACCTGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl