Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06338

HP ID(1) HP06338
Gene ID(2) 5627
Gene Symbol finder PROS1
Protein Name protein S (alpha)
RefSeq NM_000313.2
Length of RefSeq (bp) 3567
Chromosome 3q11.2
Reference DDBJ accession
UniGene Hs.64016

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi66F01 pGCAP10 GGCTGGGTCGCTGGCGCCGCCGCGCAGCACGGCTCAGACCGAGGCGCACAGGCTCGCAGC
ARiS194J01 pGCAP10 GGTTCCGCCGAGGCTCGCTGGGTCGCTGGCGCCGCCGCGCAGCACGGCTCAGACCGAGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl