Prev. |  KEGG KO K03908 > 

RIKEN DNA Bank Human Resource - PROS1

Gene ID NCBI Gene 5627 |  KEGG hsa:5627
Gene Symbol PROS1
Protein Name protein S
Synonyms PROS|PS21|PS22|PS23|PS24|PS25|PSA|THPH5|THPH6
Ortholog resources KEGG ortholog (KEGG orthology K03908) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006101 IRAK015E05 pCMV-SPORT6 BC015801 NM_000313 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE086010 M01C015A10 pDONR221 FLJ05-B05 BC015801 NM_000313  
HGE086058 M01C015C10 pDONR221 FLJ05-B05 BC015801 NM_000313  
HGE086106 M01C015E10 pDONR221 FLJ05-B05 BC015801 NM_000313  
HGE086154 M01C015G10 pDONR221 FLJ05-B05 BC015801 NM_000313  
HGE086202 M01C015I10 pDONR221 FLJ05-B05 BC015801 NM_000313  
HGE086250 M01C015K10 pDONR221 FLJ05-B05 BC015801 NM_000313  
HGE088421 M01C021A21 pDONR221 IMS03-A11 BC015801 NM_000313  
HGE088469 M01C021C21 pDONR221 IMS03-A11 BC015801 NM_000313  
HGE088517 M01C021E21 pDONR221 IMS03-A11 BC015801 NM_000313  
HGE088565 M01C021G21 pDONR221 IMS03-A11 BC015801 NM_000313  
HGE088613 M01C021I21 pDONR221 IMS03-A11 BC015801 NM_000313  
HGE088661 M01C021K21 pDONR221 IMS03-A11 BC015801 NM_000313  
HGE088709 M01C021M21 pDONR221 IMS03-A11 BC015801 NM_000313  
HGE088757 M01C021O21 pDONR221 IMS03-A11 BC015801 NM_000313  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR186521 ARi66F01 pGCAP10 NM_000313.2  
GGCTGGGTCGCTGGCGCCGCCGCGCAGCACGGCTCAGACCGAGGCGCACAGGCTCGCAGC
HKR277817 ARiS194J01 pGCAP10 NM_000313.2  
GGTTCCGCCGAGGCTCGCTGGGTCGCTGGCGCCGCCGCGCAGCACGGCTCAGACCGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl