Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06334

HP ID(1) HP06334
Gene ID(2) 90416
Gene Symbol finder C15orf57
Protein Name chromosome 15 open reading frame 57
RefSeq NM_052849.2
Length of RefSeq (bp) 1724
Chromosome 15q15.1
Reference DDBJ accession
UniGene Hs.654661

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh07D03 pGCAP1 GACAGGCGACAGAGCTGAGCCAAGCGTTTACTGGGCAGCTGTTACGCTCAGATT
RBdS083J08 pGCAP10 GAGAGCTGAGCCAAGCGTTTACTGGGCAGCTGTTACGCTCAGATTCCAAATGATAATGTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl