Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083J08

Clone ID RBdS083J08
HP ID HP06334
Gene ID 90416
Gene Symbol C15orf57
Protein Name chromosome 15 open reading frame 57
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_052849.2
Length of RefSeq (bp) 1724
Chromosome 15q15.1
Reference DDBJ accession
UniGene Hs.654661
5'-terminal sequence GAGAGCTGAGCCAAGCGTTTACTGGGCAGCTGTTACGCTCAGATTCCAAATGATAATGTT
2011.08.28