Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06296

HP ID(1) HP06296
Gene ID(2) 7138
Gene Symbol finder TNNT1
Protein Name troponin T type 1 (skeletal, slow)
RefSeq NM_003283.4
Length of RefSeq (bp) 1059
Chromosome 19q13.4
Reference DDBJ accession
UniGene Hs.631558

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh03B07 pGCAP1 TGGGGGACACGCCCAGGAGCTCTTGGGAGGGGAGGCGACCGGAGTGTGGCACTTTGGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl