Prev. |  KEGG KO K10372 > 

RIKEN DNA Bank Human Resource - TNNT1

Gene ID NCBI Gene 7138 |  KEGG hsa:7138
Gene Symbol TNNT1
Protein Name troponin T1, slow skeletal type
Synonyms ANM|NEM5|STNT|TNT|TNTS
Ortholog resource in our bank

  TNNT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084717 IRAL011N05 pOTB7 BC022086 NM_003283 Full/var
HGY087920 IRAL019N08 pDNR-LIB BC010963 NM_003283 Full/var
HGY096482 IRAL041D10 pDNR-LIB BC034143 NM_003283 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE106010 M01C065A10 pDONR221 06_07-B05 BC034143 ENST00000291901  
HGE106058 M01C065C10 pDONR221 06_07-B05 BC034143 ENST00000291901  
HGE106106 M01C065E10 pDONR221 06_07-B05 BC034143 ENST00000291901  
HGE106154 M01C065G10 pDONR221 06_07-B05 BC034143 ENST00000291901  
HGE106202 M01C065I10 pDONR221 06_07-B05 BC034143 ENST00000291901  
HGE124428 M01C111B04 pDONR221 06-2_04-D02 BC034143 ENST00000291901  
HGE124476 M01C111D04 pDONR221 06-2_04-D02 BC034143 ENST00000291901  
HGE124524 M01C111F04 pDONR221 06-2_04-D02 BC034143 ENST00000291901  
HGE124572 M01C111H04 pDONR221 06-2_04-D02 BC034143 ENST00000291901  
HGE124620 M01C111J04 pDONR221 06-2_04-D02 BC034143 ENST00000291901  
HGE124668 M01C111L04 pDONR221 06-2_04-D02 BC034143 ENST00000291901  
HGE124716 M01C111N04 pDONR221 06-2_04-D02 BC034143 ENST00000291901  
HGE124764 M01C111P04 pDONR221 06-2_04-D02 BC034143 ENST00000291901  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR121231 ARh03B07 pGCAP1 NM_003283.4  
TGGGGGACACGCCCAGGAGCTCTTGGGAGGGGAGGCGACCGGAGTGTGGCACTTTGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl