Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06278

HP ID(1) HP06278
Gene ID(2) 5165
Gene Symbol finder PDK3
Protein Name pyruvate dehydrogenase kinase, isoenzyme 3
RefSeq NM_005391.2
Length of RefSeq (bp) 1531
Chromosome Xp22.11
Reference DDBJ accession
UniGene Hs.658190

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS085K23 pGCAP10 GCTGGAGCTGCTGCTGCTGCTGCGGCGGCTGCACCGGCGGCGCCGAGGCCGAGATCGAGG
RBb57G07 pGCAP1 GAGCTGCTGCTGCTGCTGCGGCGGCTGCACCGGCGGCGCCGAGGCCGAGATCGAGGCCGG
RBdS177K03 pGCAP10 TTGNNCTGCTGCTGCTGCTGCNNNNGCTGCACCGGCGGCGCCGAGGCCGAGATCGAGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl