Prev. |  KEGG KO K00898 > 

RIKEN DNA Bank Human Resource - PDK3

Gene ID NCBI Gene 5165 |  KEGG hsa:5165
Gene Symbol PDK3
Protein Name pyruvate dehydrogenase kinase 3
Synonyms CMTX6|GS1-358P8.4
Ortholog resource in our bank

  PDK3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006365 IRAK015P05 pCMV-SPORT6 BC015948 NM_005391 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234263 ARiS085K23 pGCAP10 NM_005391.2  
GCTGGAGCTGCTGCTGCTGCTGCGGCGGCTGCACCGGCGGCGCCGAGGCCGAGATCGAGG
HKR342951 RBb57G07 pGCAP1 NM_005391.2  
GAGCTGCTGCTGCTGCTGCGGCGGCTGCACCGGCGGCGCCGAGGCCGAGATCGAGGCCGG
HKR471043 RBdS177K03 pGCAP10 NM_005391.2  
TTGNNCTGCTGCTGCTGCTGCNNNNGCTGCACCGGCGGCGCCGAGGCCGAGATCGAGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl