Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06274

HP ID(1) HP06274
Gene ID(2) 84759
Gene Symbol finder PCGF1
Protein Name polycomb group ring finger 1
RefSeq NM_032673.2
Length of RefSeq (bp) 939
Chromosome 2p13.1
Reference DDBJ accession
UniGene Hs.316750

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb57B01 pGCAP1 AGCCCGCTGTGCGCGGAGCCCTCTGCTGGGCGGAGGGGGAGTGCCAGCCCCCAGGAGCTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl