Prev. |  KEGG KO K11487 > 

RIKEN DNA Bank Human Resource - PCGF1

Gene ID NCBI Gene 84759 |  KEGG hsa:84759
Gene Symbol PCGF1
Protein Name polycomb group ring finger 1
Synonyms 2010002K04Rik|NSPC1|RNF3A-2|RNF68
Ortholog resources KEGG ortholog (KEGG orthology K11487) in the DNA Bank
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085579 IRAL013P19 pOTB7 BC004952 NM_032673 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098415 M01C046A15 pDONR221 MGC12-E08 BC004952 NM_032673  
HGE098463 M01C046C15 pDONR221 MGC12-E08 BC004952 NM_032673  
HGE098511 M01C046E15 pDONR221 MGC12-E08 BC004952 NM_032673  
HGE098559 M01C046G15 pDONR221 MGC12-E08 BC004952 NM_032673  
HGE098607 M01C046I15 pDONR221 MGC12-E08 BC004952 NM_032673  
HGE098655 M01C046K15 pDONR221 MGC12-E08 BC004952 NM_032673  
HGE098703 M01C046M15 pDONR221 MGC12-E08 BC004952 NM_032673  
HGE098751 M01C046O15 pDONR221 MGC12-E08 BC004952 NM_032673  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR342825 RBb57B01 pGCAP1 NM_032673.2  
AGCCCGCTGTGCGCGGAGCCCTCTGCTGGGCGGAGGGGGAGTGCCAGCCCCCAGGAGCTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl