Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06271

HP ID(1) HP06271
Gene ID(2) 8440
Gene Symbol finder NCK2
Protein Name NCK adaptor protein 2
RefSeq NM_003581.2
Length of RefSeq (bp) 2698
Chromosome 2q12
Reference DDBJ accession
UniGene Hs.529244

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb56E12 pGCAP1 GGGGGATCGTCAGGCCGGAGCCGCGCGGCCGAGCGGGCGGCGGGCGGAGGGGAGGGCTTG
RBd56H07 pGCAP10 TGGGGGATCGTCAGGCCGGAGCCGCGCGGCCGAGCGGGCGGNNNNNNGAGGGGAGGGCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl