Prev. |  KEGG KO K19862 > 

RIKEN DNA Bank Human Resource - NCK2

Gene ID NCBI Gene 8440 |  KEGG hsa:8440
Gene Symbol NCK2
Protein Name NCK adaptor protein 2
Synonyms GRB4|NCKbeta
Featured content T cell receptor signaling pathway (human)
Featured content Axon guidance - human
Ortholog resource in our bank

  NCK2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083027 IRAL007J11 pOTB7 BC000103 NM_001004722 Partial
HGY085547 IRAL013O11 pOTB7 BC007195 NM_001004722 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE031047 W01A077K07 pENTR-TOPO IRAL007J11 BC000103 NM_001004722  
HGE031051 W01A077K11 pENTR-TOPO IRAL007J11 BC000103 NM_001004722  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR342508 RBb56E12 pGCAP1 NM_003581.2  
GGGGGATCGTCAGGCCGGAGCCGCGCGGCCGAGCGGGCGGCGGGCGGAGGGGAGGGCTTG
HKR382575 RBd56H07 pGCAP10 NM_003581.2  
TGGGGGATCGTCAGGCCGGAGCCGCGCGGCCGAGCGGGCGGNNNNNNGAGGGGAGGGCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl