Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06268

HP ID(1) HP06268
Gene ID(2) 84901
Gene Symbol finder NFATC2IP
Protein Name nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
RefSeq NM_032815.3
Length of RefSeq (bp) 3877
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.513470

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi21B08 pGCAP10 GTGTTGTGGAGGAAAGTGTGCCATGGCGGAGCCTGTGGGGAAGCGGGGCCGCTGGTCCGG
ARi21E08 pGCAP10 GTGTTGTGGAGGAAAGTGTGCCATGGCGGAGCCTGTGGGNCNNTNNNGGNCGCTGGTCCG
RBb56C02 pGCAP1 GGTGCCATGGCGGAGCCTGTGGGGAAGCGGGGCCGCTGGTTCCGGAGGTAGCGGTGCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl