Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NFATC2IP

Gene ID (NCBI) 84901
Gene Symbol NFATC2IP
Protein Name nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
Synonyms ESC2|NIP45|RAD60
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY090983 IRAL027H15 pOTB7 BC010161 NM_032815 Partial/var
HGY103856 IRAL059K16 pOTB7 BC080628 NM_032815 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168432 ARi21B08 pGCAP10 NM_032815.3  
GTGTTGTGGAGGAAAGTGTGCCATGGCGGAGCCTGTGGGGAAGCGGGGCCGCTGGTCCGG
HKR168504 ARi21E08 pGCAP10 NM_032815.3  
GTGTTGTGGAGGAAAGTGTGCCATGGCGGAGCCTGTGGGNCNNTNNNGGNCGCTGGTCCG
HKR342450 RBb56C02 pGCAP1 NM_032815.3  
GGTGCCATGGCGGAGCCTGTGGGGAAGCGGGGCCGCTGGTTCCGGAGGTAGCGGTGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl