Prev. | 

RIKEN DNA Bank Human Resource - NFATC2IP

Gene ID NCBI Gene 84901 |  KEGG hsa:84901
Gene Symbol NFATC2IP
Protein Name nuclear factor of activated T cells 2 interacting protein
Synonyms ESC2|NIP45|RAD60
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090983 IRAL027H15 pOTB7 BC010161 NM_032815 Partial/var
HGY103856 IRAL059K16 pOTB7 BC080628 NM_032815 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR168432 ARi21B08 pGCAP10 NM_032815.3  
GTGTTGTGGAGGAAAGTGTGCCATGGCGGAGCCTGTGGGGAAGCGGGGCCGCTGGTCCGG
HKR168504 ARi21E08 pGCAP10 NM_032815.3  
GTGTTGTGGAGGAAAGTGTGCCATGGCGGAGCCTGTGGGNCNNTNNNGGNCGCTGGTCCG
HKR342450 RBb56C02 pGCAP1 NM_032815.3  
GGTGCCATGGCGGAGCCTGTGGGGAAGCGGGGCCGCTGGTTCCGGAGGTAGCGGTGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl