Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06265

HP ID(1) HP06265
Gene ID(2) 203228
Gene Symbol finder C9orf72
Protein Name chromosome 9 open reading frame 72
RefSeq NM_018325.1
Length of RefSeq (bp) 3246
Chromosome 9p21.2
Reference DDBJ accession
UniGene Hs.493639

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb52H07 pGCAP1 GGAGGCGGTGGCGAGTGGATATCTCCGGAGCATTTGGATAATGTGACAGTTGGAATGCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl