Prev. | 

RIKEN DNA Bank Human Resource - C9orf72

Gene ID NCBI Gene 203228 |  KEGG hsa:203228
Gene Symbol C9orf72
Protein Name C9orf72-SMCR8 complex subunit
Synonyms ALSFTD|DENND9|DENNL72|FTDALS|FTDALS1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067337 IRAK168F17 pBluescriptR BC068445 NM_018325 Full
HGY028964 IRAK072G20 pBluescriptR BC039112 NM_145005
HGY095131 IRAL037N19 pDNR-LIB BC020851 NM_145005 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR340975 RBb52H07 pGCAP1 NM_018325.1  
GGAGGCGGTGGCGAGTGGATATCTCCGGAGCATTTGGATAATGTGACAGTTGGAATGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl