Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06264

HP ID(1) HP06264
Gene ID(2) 23761
Gene Symbol finder PISD
Protein Name phosphatidylserine decarboxylase
RefSeq NM_014338.3
Length of RefSeq (bp) 2693
Chromosome 22q12.2
Reference DDBJ accession
UniGene Hs.420559

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS049P19 pGCAP10 GACGCTGAGAAGGAGCAGACAAGATGGCGACGTCCGTGGGGCACCGATGTCTGGGATTAC
RBb52D03 pGCAP1 GACAAGATGGCGACGTCCGTGGGGCACCGAATGTCTGGGATTACTGCACGGGGNTCGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl