Prev. |  KEGG KO K01613 > 

RIKEN DNA Bank Human Resource - PISD

Gene ID NCBI Gene 23761 |  KEGG hsa:23761
Gene Symbol PISD
Protein Name phosphatidylserine decarboxylase
Synonyms DJ858B16|PSD|PSDC|PSSC|dJ858B16.2
Ortholog resource in our bank

  PISD

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083070 IRAL007L06 pOTB7 BC001482 NM_014338
HGY090458 IRAL026C10 pOTB7 BC009315 NM_014338 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097230 M01C043B06 pDONR221 MGC11-D03 BC001482 NM_014338  
HGE097278 M01C043D06 pDONR221 MGC11-D03 BC001482 NM_014338  
HGE097326 M01C043F06 pDONR221 MGC11-D03 BC001482 NM_014338  
HGE097374 M01C043H06 pDONR221 MGC11-D03 BC001482 NM_014338  
HGE097422 M01C043J06 pDONR221 MGC11-D03 BC001482 NM_014338  
HGE097470 M01C043L06 pDONR221 MGC11-D03 BC001482 NM_014338  
HGE097518 M01C043N06 pDONR221 MGC11-D03 BC001482 NM_014338  
HGE097566 M01C043P06 pDONR221 MGC11-D03 BC001482 NM_014338  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219979 ARiS049P19 pGCAP10 NM_014338.3  
GACGCTGAGAAGGAGCAGACAAGATGGCGACGTCCGTGGGGCACCGATGTCTGGGATTAC
HKR340875 RBb52D03 pGCAP1 NM_014338.3  
GACAAGATGGCGACGTCCGTGGGGCACCGAATGTCTGGGATTACTGCACGGGGNTCGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl