Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06258

HP ID(1) HP06258
Gene ID(2) 5890
Gene Symbol finder RAD51L1
Protein Name RAD51-like 1 (S. cerevisiae)
RefSeq NM_002877.4
Length of RefSeq (bp) 1875
Chromosome 14q23-q24.2
Reference DDBJ accession
UniGene Hs.172587

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb55H01 pGCAP1 GGGGGAAACTTGAAAGTTGGATGCTGCAGACCCGGCATGGGTAGCAAGAAACTAAAACGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl