Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06245

HP ID(1) HP06245
Gene ID(2) 404550
Gene Symbol finder C16orf74
Protein Name chromosome 16 open reading frame 74
RefSeq NM_206967.2
Length of RefSeq (bp) 899
Chromosome 16q24.1
Reference DDBJ accession
UniGene Hs.461655

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb54A12 pGCAP1 TGTGACCGCCGCCGCCACCACCACCAGCGCCCGGGCGGGCCTCGCGCGCCTCGGGCGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl