Prev. | 

RIKEN DNA Bank Human Resource - C16orf74

Gene ID NCBI Gene 404550 |  KEGG hsa:404550
Gene Symbol C16orf74
Protein Name chromosome 16 open reading frame 74
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005294 IRAK013D22 pCMV-SPORT6 BC009078 NM_206967

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE092007 M01C030A07 pDONR221 MGC04-E04 BC009078 NM_206967  
HGE092055 M01C030C07 pDONR221 MGC04-E04 BC009078 NM_206967  
HGE092103 M01C030E07 pDONR221 MGC04-E04 BC009078 NM_206967  
HGE092151 M01C030G07 pDONR221 MGC04-E04 BC009078 NM_206967  
HGE092199 M01C030I07 pDONR221 MGC04-E04 BC009078 NM_206967  
HGE092247 M01C030K07 pDONR221 MGC04-E04 BC009078 NM_206967  
HGE092295 M01C030M07 pDONR221 MGC04-E04 BC009078 NM_206967  
HGE092343 M01C030O07 pDONR221 MGC04-E04 BC009078 NM_206967  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR341612 RBb54A12 pGCAP1 NM_206967.2  
TGTGACCGCCGCCGCCACCACCACCAGCGCCCGGGCGGGCCTCGCGCGCCTCGGGCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl