Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06243

HP ID(1) HP06243
Gene ID(2) 149840
Gene Symbol finder C20orf196
Protein Name chromosome 20 open reading frame 196
RefSeq NM_152504.2
Length of RefSeq (bp) 1203
Chromosome 20p12.3
Reference DDBJ accession
UniGene Hs.529340

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb53F08 pGCAP1 GGTTCCGGTTGCGGATGGTGAGTGTGTCGGGGGGCTTGGCGGCTTTTCTCCTCAGTTTTC
RBd58G07 pGCAP10 GATTGCTTCCGCGTTCCGGTTGCGGATGGTGAGTGTGTCGGNNGNNTTGGCGGCTTTTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl