Prev. | 

RIKEN DNA Bank Human Resource - SHLD1

Gene ID NCBI Gene 149840 |  KEGG hsa:149840
Gene Symbol SHLD1
Protein Name shieldin complex subunit 1
Synonyms C20orf196|RINN3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031831 IRAK079J15 pCMV-SPORT6 BC035800 NM_152504

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR341328 RBb53F08 pGCAP1 NM_152504.2  
GGTTCCGGTTGCGGATGGTGAGTGTGTCGGGGGGCTTGGCGGCTTTTCTCCTCAGTTTTC
HKR383351 RBd58G07 pGCAP10 NM_152504.2  
GATTGCTTCCGCGTTCCGGTTGCGGATGGTGAGTGTGTCGGNNGNNTTGGCGGCTTTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl