Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06221

HP ID(1) HP06221
Gene ID(2) 493753
Gene Symbol finder C2orf64
Protein Name chromosome 2 open reading frame 64
RefSeq NM_001008215.1
Length of RefSeq (bp) 1698
Chromosome 2q11.2
Reference DDBJ accession
UniGene Hs.596537

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS150P18 pGCAP10 GGGAAGTTGTTGCCGCTGGCTTCCGGTCCCCTGAGACTGGGGCCTCGCTCGCTCCCGACC
ARiS194H18 pGCAP10 GCCCGACCCGGTTGCAAGTGTTGCGGTGGGAGAAAGTCGCGTCCGCATCGGAGGGGAAGC
RBb40G08 pGCAP1 GGCCGGAAGTTGTTGCCGCTGGCTTCCGGTCCCCTGAGACTGGGGCCTCGCTCGCTCCCG
RBd26B10 pGCAP10 GGAGACTGGGGCCTCGCTCGCTCCCGACCCGGTTGCAAGTGTTGCGGTGGGAGAAAGTCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl