Prev. |  KEGG KO K18178 > 

RIKEN DNA Bank Human Resource - COA5

Gene ID NCBI Gene 493753 |  KEGG hsa:493753
Gene Symbol COA5
Protein Name cytochrome c oxidase assembly factor 5
Synonyms 6330578E17Rik|C2orf64|CEMCOX3|Pet191
Ortholog resource in our bank

  COA5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX039275 IRAK098D03 pCMV-SPORT6 BC047722 NM_001008215

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR260378 ARiS150P18 pGCAP10 NM_001008215.1  
GGGAAGTTGTTGCCGCTGGCTTCCGGTCCCCTGAGACTGGGGCCTCGCTCGCTCCCGACC
HKR277786 ARiS194H18 pGCAP10 NM_001008215.1  
GCCCGACCCGGTTGCAAGTGTTGCGGTGGGAGAAAGTCGCGTCCGCATCGGAGGGGAAGC
HKR336152 RBb40G08 pGCAP1 NM_001008215.1  
GGCCGGAAGTTGTTGCCGCTGGCTTCCGGTCCCCTGAGACTGGGGCCTCGCTCGCTCCCG
HKR370434 RBd26B10 pGCAP10 NM_001008215.1  
GGAGACTGGGGCCTCGCTCGCTCCCGACCCGGTTGCAAGTGTTGCGGTGGGAGAAAGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl