Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06213

HP ID(1) HP06213
Gene ID(2) 8996
Gene Symbol finder NOL3
Protein Name nucleolar protein 3 (apoptosis repressor with CARD domain)
RefSeq NM_003946.3
Length of RefSeq (bp) 1402
Chromosome 16q21-q23
Reference DDBJ accession
UniGene Hs.513667

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi61B11 pGCAP10 GGACAGAAGGAGGAGCCTGAGGAGGAGACAGGACAGAGCGTCTGGAGAGGCAGGAGGACA
RBb39G08 pGCAP1 GCCTTTCTGCACCGTCATCTCCTGCCCCGCCGAGGCTTGACCCCCCCGACAATGGGCAAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl