DNA Bank Top | 

RIKEN DNA Bank Human Resource - NOL3

Gene ID NCBI Gene 8996 |  KEGG hsa:8996
Gene Symbol NOL3
Protein Name nucleolar protein 3
Synonyms ARC|FCM|MYOCL1|MYP|NOP|NOP30

Link

Ortholog resource in our bank

External database

human NOL3

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04956 SEREX clone NGO-Pr-118 (ID 2285) #1 SEREX clone NGO-Pr-118 (ID 2285) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083177 IRAL007P17 pOTB7 BC012798 NM_003946

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024746 W01A061O10 pENTR-TOPO IRAL007P17 BC012798 NM_003946  
HGE024748 W01A061O12 pENTR-TOPO IRAL007P17 BC012798 NM_003946  
HGE024750 W01A061O14 pENTR-TOPO IRAL007P17 BC012798 NM_003946  
HGE024752 W01A061O16 pENTR-TOPO IRAL007P17 BC012798 NM_003946  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR184435 ARi61B11 pGCAP10 NM_003946.3  
GGACAGAAGGAGGAGCCTGAGGAGGAGACAGGACAGAGCGTCTGGAGAGGCAGGAGGACA
HKR335752 RBb39G08 pGCAP1 NM_003946.3  
GCCTTTCTGCACCGTCATCTCCTGCCCCGCCGAGGCTTGACCCCCCCGACAATGGGCAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl