Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06204

HP ID(1) HP06204
Gene ID(2) 29089
Gene Symbol finder UBE2T
Protein Name ubiquitin-conjugating enzyme E2T (putative)
RefSeq NM_014176.3
Length of RefSeq (bp) 935
Chromosome 1q32.1
Reference DDBJ accession
UniGene Hs.5199

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe81D12 pKA1U5 GGTTGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTC
RBb45C03 pGCAP1 GGTTGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGCCAGCTC
RBb46C03 pGCAP1 TGGTTGGTCCGCGCGCTTGCTGCGATTGNTGAGGGGTGTCAGCTCAGTGCATCCCAGGCA
RBb72E06 pGCAP1 GGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTCTTA
RBd03D08 pGCAP10 GGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTCTTAG
RBd05E02 pGCAP10 CGGCCGGCCGATGGGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTCTTAGT
RBd10C07 pGCAP10 GGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTCTTAG
RBd19C05 pGCAP10 GGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTCTTA
RBd83F10 pGCAP10 GGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTCTTA
RBdS104A21 pGCAP10 GGTTGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTC
RBdS156J20 pGCAP10 GGTTGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTC
RBdS177I06 pGCAP10 GGTTGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl