Prev. |  KEGG KO K13960 > 

RIKEN DNA Bank Human Resource - UBE2T

Gene ID NCBI Gene 29089 |  KEGG hsa:29089
Gene Symbol UBE2T
Protein Name ubiquitin conjugating enzyme E2 T
Synonyms FANCT|HSPC150|PIG50
Ortholog resources KEGG ortholog (KEGG orthology K13960) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080869 IRAL002C21 pOTB7 BC004152 NM_014176 Full
HGY083967 IRAL009P07 pOTB7 BC019284 NM_014176 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR072484 ARe81D12 pKA1U5 NM_014176.3  
GGTTGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTC
HKR338051 RBb45C03 pGCAP1 NM_014176.3  
GGTTGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGCCAGCTC
HKR338451 RBb46C03 pGCAP1 NM_014176.3  
TGGTTGGTCCGCGCGCTTGCTGCGATTGNTGAGGGGTGTCAGCTCAGTGCATCCCAGGCA
HKR348902 RBb72E06 pGCAP1 NM_014176.3  
GGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTCTTA
HKR361280 RBd03D08 pGCAP10 NM_014176.3  
GGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTCTTAG
HKR362098 RBd05E02 pGCAP10 NM_014176.3  
CGGCCGGCCGATGGGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTCTTAGT
HKR364055 RBd10C07 pGCAP10 NM_014176.3  
GGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTCTTAG
HKR367653 RBd19C05 pGCAP10 NM_014176.3  
GGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTCTTA
HKR393330 RBd83F10 pGCAP10 NM_014176.3  
GGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTCTTA
HKR441621 RBdS104A21 pGCAP10 NM_014176.3  
GGTTGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTC
HKR462636 RBdS156J20 pGCAP10 NM_014176.3  
GGTTGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTC
HKR470998 RBdS177I06 pGCAP10 NM_014176.3  
GGTTGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTCAGTGCATCCCAGGCAGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl