Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06164

HP ID(1) HP06164
Gene ID(2) 29959
Gene Symbol finder NRBP1
Protein Name nuclear receptor binding protein 1
RefSeq NM_013392.2
Length of RefSeq (bp) 2212
Chromosome 2p23
Reference DDBJ accession
UniGene Hs.515876

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi58G09 pGCAP10 GGGAGCTGAAGCGCAGGCTGCGGGGCGCGGAGTCGGGAGTGCAGGCCTGAGTGTTCCTTC
ARiS045J20 pGCAP10 GGCCCGCAGTTCGGTTGCGCTGCGGAGCGCAGCTGTGAGGGAGTCGCTGTGATCCGGGGC
RBd33C07 pGCAP10 GCGGTTGCGCTGCGGAGCGCAGCTGTGAGGGAGTCGCTGTGATCCGGGGCCCCGGAACCC
RBd77E07 pGCAP10 GGGTTGCGCTGCGGAGCGCAGCTGTGAGGGAGTCGCTGTGATCCGGGGCCCCGGAACCCG
RBd78E06 pGCAP10 GGAGTCNCTGTGATCCGGGGCCCCGGAACCCGAGCTGGAGCTGAAGCGCAGGCTGCGGGG
RBdS007K08 pGCAP10 GGGTTGCGCTGCGGAGCGCAGCTGTGAGGGAGTCGCTGTGATCCGGGGCCCCGGAACCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl