Prev. |  KEGG KO K08875 > 

RIKEN DNA Bank Human Resource - NRBP1

Gene ID NCBI Gene 29959 |  KEGG hsa:29959
Gene Symbol NRBP1
Protein Name nuclear receptor binding protein 1
Synonyms BCON3|MADM|MUDPNP|NRBP
Ortholog resource in our bank

  NRBP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083219 IRAL008A19 pOTB7 BC001221 NM_013392 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE042044 W01A105B20 pENTR-TOPO flj0037l05 AK001946 NM_013392  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR183353 ARi58G09 pGCAP10 NM_013392.2  
GGGAGCTGAAGCGCAGGCTGCGGGGCGCGGAGTCGGGAGTGCAGGCCTGAGTGTTCCTTC
HKR218236 ARiS045J20 pGCAP10 NM_013392.2  
GGCCCGCAGTTCGGTTGCGCTGCGGAGCGCAGCTGTGAGGGAGTCGCTGTGATCCGGGGC
HKR373255 RBd33C07 pGCAP10 NM_013392.2  
GCGGTTGCGCTGCGGAGCGCAGCTGTGAGGGAGTCGCTGTGATCCGGGGCCCCGGAACCC
HKR390903 RBd77E07 pGCAP10 NM_013392.2  
GGGTTGCGCTGCGGAGCGCAGCTGTGAGGGAGTCGCTGTGATCCGGGGCCCCGGAACCCG
HKR391302 RBd78E06 pGCAP10 NM_013392.2  
GGAGTCNCTGTGATCCGGGGCCCCGGAACCCGAGCTGGAGCTGAAGCGCAGGCTGCGGGG
HKR403048 RBdS007K08 pGCAP10 NM_013392.2  
GGGTTGCGCTGCGGAGCGCAGCTGTGAGGGAGTCGCTGTGATCCGGGGCCCCGGAACCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl