Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06158

HP ID(1) HP06158
Gene ID(2) 9100
Gene Symbol finder USP10
Protein Name ubiquitin specific peptidase 10
RefSeq NM_005153.2
Length of RefSeq (bp) 3399
Chromosome 16q24.1
Reference DDBJ accession
UniGene Hs.136778

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi27D04 pGCAP10 TGGGTGTATGTGCGGGCGAGAAGATGGCGGCGGCGGGGGAAGCAGCGTGAGCAGCCGGAG
RBdS104P23 pGCAP10 GGTGTATGTGCGGGCGAGAAGATGGCGGCGGCGGGGGAAGCAGCGTGAGCAGCCGGAGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl