Prev. |  KEGG KO K11841 > 

RIKEN DNA Bank Human Resource - USP10

Gene ID NCBI Gene 9100 |  KEGG hsa:9100
Gene Symbol USP10
Protein Name ubiquitin specific peptidase 10
Synonyms UBPO
Ortholog resource in our bank

  USP10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082760 IRAL006O24 pOTB7 BC000263 NM_005153 Full
HGY100040 IRAL050B16 pOTB7 BC064516 NM_005153 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR170876 ARi27D04 pGCAP10 NM_005153.2  
TGGGTGTATGTGCGGGCGAGAAGATGGCGGCGGCGGGGGAAGCAGCGTGAGCAGCCGGAG
HKR441983 RBdS104P23 pGCAP10 NM_005153.2  
GGTGTATGTGCGGGCGAGAAGATGGCGGCGGCGGGGGAAGCAGCGTGAGCAGCCGGAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl