Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06129

HP ID(1) HP06129
Gene ID(2) 10201
Gene Symbol finder NME6
Protein Name non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)
RefSeq NM_005793.3
Length of RefSeq (bp) 1189
Chromosome 3p21
Reference DDBJ accession
UniGene Hs.465558

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi71G10 pGCAP10 GGAACCCGCAGCCGGACTTCTGCTGCACTGGGGCTCCGAATGACCCAGAATCTGGGGTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl