Prev. |  KEGG KO K00940 > 

RIKEN DNA Bank Human Resource - NME6

Gene ID NCBI Gene 10201 |  KEGG hsa:10201
Gene Symbol NME6
Protein Name NME/NM23 nucleoside diphosphate kinase 6
Synonyms IPIA-ALPHA|NDK 6|NM23-H6
Ortholog resource in our bank

  NME6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081301 IRAL003E05 pOTB7 BC001808 NM_005793 Full
HGY084294 IRAL010M06 pOTB7 BC012828 NM_005793

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR188554 ARi71G10 pGCAP10 NM_005793.3  
GGAACCCGCAGCCGGACTTCTGCTGCACTGGGGCTCCGAATGACCCAGAATCTGGGGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl