Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06124

HP ID(1) HP06124
Gene ID(2) 11252
Gene Symbol finder PACSIN2
Protein Name protein kinase C and casein kinase substrate in neurons 2
RefSeq NM_007229.2
Length of RefSeq (bp) 2171
Chromosome 22q13.2-q13.33
Reference DDBJ accession
UniGene Hs.162877

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS096E16 pGCAP10 GAGTGCTGCCGGAGCAAAAGCGGNNNCGGGAGCCCGGCCGGAGCTGGGTCTGGAGACGCC
RBd23F04 pGCAP10 GGGGCAGGGCTGGGCAGTGCTGCCGGAGCAAAAGCGGTAGCGGGAGCCCGGCCGGAGCTG
RBdS105N21 pGCAP10 TGTTGAGTGCTGCCGGAGCAAAAGCGGTAGCGGGAGCCCGGCCGGAGCTGGGTCTGGAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl